Venular blood DAPT secretase velocity (V) was measured using the Microvessel Velocity OD-RT optical Doppler velocimeter (Circusoft Instrumentation) with corresponding software. Venular wall shear rate (��) was calculated using the formula: �� = 4.9 �� 8(Vmean/D), where D is the venule diameter (23). Euthanasia was by injection of 160 mg/kg pentobarbital, then exsanguination under anesthesia. Systemic leukocytes counts were determined using the Leuko-TIC Kit (Bioanalytic) according to manufacturer instructions with an enhanced Neubauer hemocytometer. All animal procedures were approved by the Institutional Animal Care and Use Committee of Temple University and conformed to the Guide for the Care and Use of Laboratory Animals, published by the National Institutes of Health (NIH, 8th ed., 2011).
RNA extraction and quantitative RT-PCR. RNA was isolated using the RNeasy Mini Kit (Qiagen) and reverse transcribed into cDNA using the Superscript III First-Strand Synthesis System (Invitrogen, Carlsbad, CA) as we have described, and target genes were amplified using Maxima SYBR Green/ROX qPCR Master Mix (Fermentas) in an Eppendorf Realplex4 Mastercycler (5). Multiple mRNAs (Ct values) were quantitated simultaneously by the Eppendorf software. Primer pairs were purchased from Integrated DNA Technologies (Coralville, IA).
The following primer pairs were used: GAPDH forward (F): CGAGAGTCAGCCGCATCTT, reverse (R): CCCCATGGTGTCTGAGCG; ICAM-1 F: CTCCAATGTGCCAGGCTTG, R: CAGTGGGAAAGTGCCATCCT; VCAM-1 F: TTCCCTAGAGATCCAGAAATCGAG, R: CTTGCAGCTTACAGTGACAGAGC; VLA-4 ��1-integrin F: GCGGAAAAGATGAATTTACAACCA, R: TTCTCCACATGATTTGGCATTTGGCATTTG; E-selectin F: TCTGGGAATTGGGACAACG, R: CCTCACAGGTGAAGTTGCAG; P-selectin F: TTCCATTGTCTAGAGGGCC, R: AATGGTCCTTGGCAGGTTG; CD18 (Mac-1 and LFA-1 shared ��2-integrin) F: GTGTCAGGACTTTACGACCC, R: CTTTGCTACCAGTCTGCCC; CD11B (Mac-1 ��M-integrin) F: GTGATGCTGTTCTCTACGGG, R: TCAGCTTGTCCCCATTTACG; Drug_discovery CD11A (LFA-1 ��L-integrin) F: CCCCACAGATGGAAGCATTT, R: GAAGAGGTAACACAGGCCAC; TNFR1 F: TTCACCGCTTCAGAAAACCA, R: AAGAGATCTCCACCTGACCC. Statistical analysis. Results are expressed as means �� SE. Differences between groups were evaluated using one-way ANOVA. Individual mean differences were evaluated using the Newman-Keuls post test and confirmed by paired t-tests where appropriate. Differences were considered significant at a level of P < 0.05. RESULTS IL-19 reduces TNF-��-induced cell adhesion molecule expression in human ECs. We previously demonstrated that IL-19 is expressed in cultured human endothelial cells in response to inflammatory stimuli (14). Considering that IL-19 has putative anti-inflammatory effects, we tested whether IL-19 treatment could decrease expression of adhesion molecules on human endothelial cells.