Methods Culturing conditions and recombinant DNA manipulations Ms strain mc2155 (ATCC 700084) and its derivatives were routinely cultured under standard conditions (37°C, 225 rpm) in Middlebrook 7H9 (Difco) supplemented with 10% ADN (5% BSA, 2% dextrose, 0.85% NaCl), 0.2% glycerol and 0.05% Tween-80 (supplemented 7H9) or in Middlebrook 7H11 (Difco) supplemented with 10% ADN (supplemented 7H11) [55]. E. coli DH5α (Invitrogen) was cultured under standard conditions in Luria-Bertani media [56]. When required, kanamycin (30 μg/ml), hygromycin (50 μg/ml), sucrose (2%) and/or X-gal

(70 μg/ml) were added to the media. General recombinant DNA manipulations were carried out by standard methods and using E. coli as the primary cloning host [56]. Molecular biology reagents were obtained check details from Sigma, Invitrogen, New England Biolabs, Novagen, QIAGEN, or Stratagene. Oligonucleotides were selleck screening library purchased from Integrated DNA Technologies, Inc. PCR-generated DNA fragments used in plasmid constructions were sequenced to verify fidelity. Chromosomal DNA isolation from and plasmid electroporation into mycobacteria were carried out as reported

[55]. Table 1 lists the plasmids and oligonucleotide primers used in this study. Table 1 Plasmids and oligonucleotide primers Plasmid Characteristics Source or Reference pCR2.1-TOPO Cloning vector, kanamycin resistance and ampicillin resistance genes Invitrogen pCP0 Vector for gene expression in mycobacteria, kanamycin resistance gene [4] pCP0-gplH pCP0 expressing M. smegmatis gplH This study pCP0-mbtHMs pCP0 expressing M. smegmatis mbtH (MSMEG_4508) [35] p2NIL Kanamycin resistance gene and OriE [57] pGOAL19 Hygromycin resistance gene, sacB-lacZ PacI cassette, and OriE [57] selleck compound p2NIL-GOALc-ΔgplHc Delivery vector carrying a gplH deletion cassette (ΔgplHc) This study Oligonucleotide Sequence (5’ to 3’) Characteristics pepOF GGTACCTGTTCAACGCGGCCAGAGCGTCATTGGTCTCGGCCA

KpnI pepOR TTAATTAATGTTGCAACAGCTCCCTGATCCGGATGTCGACGTGCTTG PacI pepIR TCAGCCGTCAAGAGCAAAGCTGCCGTTGTCGTCATCGAACGGGTTGAT SOE PCR pepIF CGACAACGGCAGCTTTGCTCTTGACGGCTGAGTCAAATAGTCTGTTG Meloxicam SOE PCR pepF CTGCAGTGAACAGCCGGGAGAAACGT PstI pepR AAGCTTCCCAACAGACTATTTGACTCAGCCG HindIII Construction of M. smegmatis ΔgplH Ms ΔgplH was engineered using the p2NIL/pGOAL19-based flexible cassette method [57] as previously reported [4, 31, 35, 58]. A suicide delivery vector (p2NIL-GOALc-ΔgplHc, see below) carrying a gplH (MSMEG_0399) deletion cassette (ΔgplHc) was used to generate Ms ΔgplH. The vector was electroporated into Ms and transformants with a potential p2NIL-GOALc-ΔgplHc integration via a single-crossover event (blue colonies) were selected on supplemented 7H11 containing hygromycin, kanamycin, and X-gal. The selected transformants were then grown in antibiotic-free supplemented 7H9, and subsequently plated for single colonies on supplemented 7H11 containing sucrose and X-gal.